Review



trueguide synthetic sgrna (tas2r14 (u*g*a* ucggauccucacugcuu + modified scaffold)  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    Thermo Fisher trueguide synthetic sgrna (tas2r14 (u*g*a* ucggauccucacugcuu + modified scaffold)
    Trueguide Synthetic Sgrna (Tas2r14 (U*G*A* Ucggauccucacugcuu + Modified Scaffold), supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/trueguide+modified+synthetic+sgrnas/pm39277814-99-34-52
    Average 90 stars, based on 1 article reviews
    trueguide synthetic sgrna (tas2r14 (u*g*a* ucggauccucacugcuu + modified scaffold) - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    other:

    Article Title: Enhancer Control of MicroRNA miR-155 Expression in Epstein-Barr Virus-Infected B Cells
    Article Snippet: Guides were selected that had an on-target and off-target score 500 that was above 60% (26873822 CTATCCTTAACAGAACACCC and 26875376 501 TTTAACTAGAACCTTAGACA) and then ordered as TrueGuide Modified Synthetic 502 sgRNAs from GeneArt (Invitrogen).

    Modification:

    Article Title: Enhancer control of miR-155 expression in Epstein-Barr virus infected B cells
    Article Snippet: CRISPR guides were designed using www.benchling.com_to excise miR-155HG enhancer 2 from the B cell genome in the IB4 LCL by targeting genomic regions located 5’ and 3’ of the enhancer. .. Guides were selected that had an on-target and off-target score that was above 60% (26873822 CTATCCTTAACAGAACACCC and 26875376 TTTAACTAGAACCTTAGACA) and then ordered as TrueGuide Modified Synthetic sgRNAs from GeneArt (Invitrogen). ..



    Similar Products

    90
    Thermo Fisher trueguide synthetic sgrna (tas2r14 (u*g*a* ucggauccucacugcuu + modified scaffold)
    Trueguide Synthetic Sgrna (Tas2r14 (U*G*A* Ucggauccucacugcuu + Modified Scaffold), supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/trueguide+modified+synthetic+sgrnas/pm39277814-99-34-52
    Average 90 stars, based on 1 article reviews
    trueguide synthetic sgrna (tas2r14 (u*g*a* ucggauccucacugcuu + modified scaffold) - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher sgrna trueguide modified synthetic sgrnas
    Sgrna Trueguide Modified Synthetic Sgrnas, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/trueguide+modified+synthetic+sgrnas/sgrna+trueguide+modified+synthetic+sgrnas/pm37098350-313-15-20
    Average 90 stars, based on 1 article reviews
    sgrna trueguide modified synthetic sgrnas - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    86
    Thermo Fisher trueguide modified synthetic sgrna
    Trueguide Modified Synthetic Sgrna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/trueguide+modified+synthetic+sgrnas/pmc08690596-233-5-9
    Average 86 stars, based on 1 article reviews
    trueguide modified synthetic sgrna - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    90
    Thermo Fisher trueguide modified synthetic sgrnas
    Trueguide Modified Synthetic Sgrnas, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/trueguide+modified+synthetic+sgrnas/10__1128_slash_jvi__00716___18-217-25-31
    Average 90 stars, based on 1 article reviews
    trueguide modified synthetic sgrnas - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    Image Search Results